HDAC Inhibitors as Epigenetic Regulators

Each scFv was composed of immunoglobulin variable heavy chain (VH) and immunoglobulin variable light chain (VL) domains, which were linked by a 15-residue peptide linker (G4S)3 (light brown boxes). treatment of hepatocellular carcinoma. Keywords: bispecific antibodies, T-cell engager, transferrin receptor, tumor immunotherapy, solid tumor Introduction Redirecting the activity of T cells by bispecific antibodies against tumor cells, impartial of their intrinsic antigen-specific T cell receptor (TCR) recognition, is a potent approach to treat cancer (1C4). The concept of bispecific T-cell engager (BiTE) is based on recognition of an Rabbit polyclonal to TLE4 antigen on tumor cell and simultaneous binding to the CD3 epsilon chain (CD3) within the TCR complex on T cells (5, 6). It bridges malignant tumor UNC0321 cells directly to CD3-positive T cells, bypassing TCR specificity, and major histocompatibility complex (MHC) class I molecules (7C9). This triggers T cell activation, including the release of cytotoxic molecules, cytokines, and induction of T-cell proliferation (10). In other words, BiTE antibodies direct the host’s immune system and activate specifically cytotoxic T cells to kill malignancy cells. Blinatumomab (Blincyto), which is usually reactive with the pan B cell antigen CD19, has been approved by the FDA for treatment of B cell neoplasms in 2014 (11C13). Therapeutic BiTE antibodies are developed to direct to high-density, cell surface proteins (14). Transferrin receptor (TfR), a disulfide-linked transmembrane glycoprotein homodimer, is an essential protein involved in iron uptake and the regulation of cell growth (15). It is expressed with high levels on rapidly proliferating tumor cells, as well as circulating tumor cells, tumor precursor cells, or cells that have been activated during tumorigenesis (16C18). In addition, the TfR expression level is associated with tumor typing and poor prognosis (16, 19). This makes TfR a stylish target for cancer immunotherapy. TfR Abs have been explored for the treatment of various tumors (20C22). Our previous studies also demonstrated that TfR Abs could recognize tumor cells with high efficiency and UNC0321 131I-TfR Ab displayed a feature of specific accumulation at tumor tissue (23C25). Also these TfR Ab-modified therapeutic agents exhibit tumor-specific cytotoxic activities (26C29). Here, we describe a TfR bispecific T-cell UNC0321 engager (TfR-BiTE), an anti-human TfR and anti-human CD3 recombinant antibody, a tandem scFv, as T cellCrecruiting therapeutics for TfR+ malignancies. We provide evidence of potent and killing activity for TfR positive HepG2 cells. This study highlights a new approach in tumor immunotherapy and provides the rationale for treatment of TfR-positive tumors. Materials and Methods Cell Culture HepG2, Luc-HepG2, HT1080, and HepG2.215 cells were stored in our lab. MX-1 cells were kindly provided by Professor Xiyun Yan (Chinese Academy of Sciences, Beijing, China). HepG2, HepG2.215, and MX-1 cells were cultured in DMEM. HT1080 and peripheral blood mononuclear cells (PBMCs) were cultured in RPMI 1640 supplemented with 10% fetal bovine serum (FBS), penicillin, and streptomycin, at 37C in an atmosphere of 5% CO2. PBMCs were isolated from healthy donors by Ficoll density centrifugation. Stably transfected CHO-DG44 cells were cultured in CD OptiCHOTM Medium (#12681-011, Gibco, USA) supplemented with L-glutamine (40 mL/L, #25030-081, Gibco, USA) and 1 M MTX (Sigma-Aldrich, Saint Louis, MO, USA). CD3+ cells were depleted from PBMCs using CD3 MicroBeads (human, #130-050-101, Miltenyi Biotec, Germany) according to the manufacturer’s recommendation. Construction of TfR-BiTE The eukaryotic plasmid pOptiVEC-TfR-CD3-His encoding the full length of TfR-BiTE and was constructed as follows. The fragments were amplified from plasmid pET-28(a)-CD3-scFv (preserved by our lab) by PCR with primers pairs (p1: CTAGCTAGCACCGGTTCCCAGGTCCAGCTGC; p2: CGCGGATCCTTTTATTTCCAACTTTG). Then, the Efficacy Studies All experimental procedures were approved by the Ethics Committee of Tongji Medical College of Huazhong University of Science and Technology. Severely immunocompromised NCG mice (female, 3C4 weeks, purchased from the Nanjing Biomedical Research Institute of Nanjing University) were subcutaneously inoculated with 1 106 Luc-HepG2 cells. On day 7, 1 107 PBMCs were infused via tail injection. Six hours later, 20 g TfR-BiTE or control mAb mixture was injected intravenously. Over the treatment course, PBMCs were given once, and BiTE was given every day for 7 days. The tumor volume and the mouse weight were measured every second day. When the tumor volume was ~2,000 mm3, the mice were euthanized, and the tumors were harvested and photographed. Tumor infiltrated T-cells were analyzed by immunohistochemistry using anti-human CD3 (Kit-0003, Maxim biotechnologies, China). Hepatotoxicity and nephrotoxicity induced by TfR-BiTE were.